Creation: The Origin of Life / The Future of Life

Valutazione media 4,03
( su 379 valutazioni fornite da GoodReads )
 
9780241954690: Creation: The Origin of Life / The Future of Life

Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives.

'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday

The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, offering answers to the very grandest of questions before arriving at a thrilling solution.

'A superbly written explanation' Brian Cox

This same science has led to a technological revolution: the ability to create entirely new life forms within the lab, known as synthetic biology. The Future of Life introduces these remarkable innovations, explains how they work, and presents a powerful argument for their benefit to humankind.

'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating.' Sunday Telegraph

'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer

'The perfect primer on the past and future of DNA' Guardian

'Susenseful, erudite and thrilling' Prospect

'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain

'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili

'A fascinating glimpse into our past and future. Rutherford argues persuasively against those who seek to hold back scientific progress. His illuminating book is full of optimism about what we might be able to achieve' Sunday Times

'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk

'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts

'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome

'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times

Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book.

TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG

Le informazioni nella sezione "Riassunto" possono far riferimento a edizioni diverse di questo titolo.

Recensione:

Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller ( Mail on Sunday)

One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet ( Observer)

Fascinating. The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny ( Sunday Telegraph)

The perfect primer on the past and future of DNA ( Guardian)

L'autore:

Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book.

Le informazioni nella sezione "Su questo libro" possono far riferimento a edizioni diverse di questo titolo.

I migliori risultati di ricerca su AbeBooks

1.

Adam Rutherford
Editore: Penguin Books Ltd, United Kingdom (2014)
ISBN 10: 024195469X ISBN 13: 9780241954690
Nuovi Paperback Quantità: 10
Da
The Book Depository
(London, Regno Unito)
Valutazione libreria
[?]

Descrizione libro Penguin Books Ltd, United Kingdom, 2014. Paperback. Condizione libro: New. 196 x 128 mm. Language: English . Brand New Book. Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives. Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller Mail on Sunday The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, offering answers to the very grandest of questions before arriving at a thrilling solution. A superbly written explanation Brian Cox This same science has led to a technological revolution: the ability to create entirely new life forms within the lab, known as synthetic biology. The Future of Life introduces these remarkable innovations, explains how they work, and presents a powerful argument for their benefit to humankind. The reader s sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford s argument are worth every reader s scrutiny. Fascinating. Sunday Telegraph One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet Observer The perfect primer on the past and future of DNA Guardian Susenseful, erudite and thrilling Prospect A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know Dara O Briain This is a quite delightful two-books-in-one. Rutherford s lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology Jim Al Khalili A fascinating glimpse into our past and future. Rutherford argues persuasively against those who seek to hold back scientific progress. His illuminating book is full of optimism about what we might be able to achieve Sunday Times Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers Alice Roberts An engaging account of both the mystery of life s origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology Matt Ridley, author of Genome I warmly recommend Creation. Rutherford s academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English Financial Times Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4 s weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: Playing God (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book. TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG. Codice libro della libreria APG9780241954690

Maggiori informazioni su questa libreria | Fare una domanda alla libreria

Compra nuovo
EUR 9,18
Convertire valuta

Aggiungere al carrello

Spese di spedizione: GRATIS
Da: Regno Unito a: U.S.A.
Destinazione, tempi e costi

2.

Rutherford Adam, Rutherford Adam
ISBN 10: 024195469X ISBN 13: 9780241954690
Nuovi Quantità: 5
Da
GreatBookPrices
(Columbia, MD, U.S.A.)
Valutazione libreria
[?]

Descrizione libro Condizione libro: New. Codice libro della libreria 18465555-n

Maggiori informazioni su questa libreria | Fare una domanda alla libreria

Compra nuovo
EUR 7,23
Convertire valuta

Aggiungere al carrello

Spese di spedizione: EUR 2,43
In U.S.A.
Destinazione, tempi e costi

3.

Adam Rutherford
Editore: Penguin Books Ltd, United Kingdom (2014)
ISBN 10: 024195469X ISBN 13: 9780241954690
Nuovi Paperback Quantità: 10
Da
The Book Depository US
(London, Regno Unito)
Valutazione libreria
[?]

Descrizione libro Penguin Books Ltd, United Kingdom, 2014. Paperback. Condizione libro: New. 196 x 128 mm. Language: English . Brand New Book. Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives. Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller Mail on Sunday The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, offering answers to the very grandest of questions before arriving at a thrilling solution. A superbly written explanation Brian Cox This same science has led to a technological revolution: the ability to create entirely new life forms within the lab, known as synthetic biology. The Future of Life introduces these remarkable innovations, explains how they work, and presents a powerful argument for their benefit to humankind. The reader s sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford s argument are worth every reader s scrutiny. Fascinating. Sunday Telegraph One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet Observer The perfect primer on the past and future of DNA Guardian Susenseful, erudite and thrilling Prospect A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know Dara O Briain This is a quite delightful two-books-in-one. Rutherford s lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology Jim Al Khalili A fascinating glimpse into our past and future. Rutherford argues persuasively against those who seek to hold back scientific progress. His illuminating book is full of optimism about what we might be able to achieve Sunday Times Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers Alice Roberts An engaging account of both the mystery of life s origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology Matt Ridley, author of Genome I warmly recommend Creation. Rutherford s academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English Financial Times Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4 s weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: Playing God (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book. TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG. Codice libro della libreria APG9780241954690

Maggiori informazioni su questa libreria | Fare una domanda alla libreria

Compra nuovo
EUR 9,72
Convertire valuta

Aggiungere al carrello

Spese di spedizione: GRATIS
Da: Regno Unito a: U.S.A.
Destinazione, tempi e costi

4.

Rutherford, Adam
ISBN 10: 024195469X ISBN 13: 9780241954690
Nuovi Quantità: > 20
Da
BWB
(Valley Stream, NY, U.S.A.)
Valutazione libreria
[?]

Descrizione libro Condizione libro: New. Depending on your location, this item may ship from the US or UK. Codice libro della libreria 97802419546900000000

Maggiori informazioni su questa libreria | Fare una domanda alla libreria

Compra nuovo
EUR 9,77
Convertire valuta

Aggiungere al carrello

Spese di spedizione: GRATIS
In U.S.A.
Destinazione, tempi e costi

5.

Adam Rutherford
Editore: Penguin 2014-02-06 (2014)
ISBN 10: 024195469X ISBN 13: 9780241954690
Nuovi Quantità: 5
Da
Chiron Media
(Wallingford, Regno Unito)
Valutazione libreria
[?]

Descrizione libro Penguin 2014-02-06, 2014. Condizione libro: New. Brand new book, sourced directly from publisher. Dispatch time is 24-48 hours from our warehouse. Book will be sent in robust, secure packaging to ensure it reaches you securely. Codice libro della libreria NU-GRD-05066736

Maggiori informazioni su questa libreria | Fare una domanda alla libreria

Compra nuovo
EUR 8,08
Convertire valuta

Aggiungere al carrello

Spese di spedizione: EUR 3,46
Da: Regno Unito a: U.S.A.
Destinazione, tempi e costi

6.

Rutherford, Adam
Editore: Penguin Books Ltd (2014)
ISBN 10: 024195469X ISBN 13: 9780241954690
Nuovi Brossura Quantità: 16
Valutazione libreria
[?]

Descrizione libro Penguin Books Ltd, 2014. Condizione libro: New. Tells a story that uses science to explain what life is and where it first came from, offering answers to the very grandest of questions before arriving at a fresh solution. Num Pages: 272 pages. BIC Classification: PDZ; PSAJ. Category: (G) General (US: Trade). Dimension: 197 x 129 x 20. Weight in Grams: 258. . 2014. Paperback. . . . . . Codice libro della libreria V9780241954690

Maggiori informazioni su questa libreria | Fare una domanda alla libreria

Compra nuovo
EUR 13,11
Convertire valuta

Aggiungere al carrello

Spese di spedizione: GRATIS
Da: Irlanda a: U.S.A.
Destinazione, tempi e costi

7.

Adam Rutherford
ISBN 10: 024195469X ISBN 13: 9780241954690
Nuovi Paperback Quantità: > 20
Da
Ria Christie Collections
(Uxbridge, Regno Unito)
Valutazione libreria
[?]

Descrizione libro Paperback. Condizione libro: New. Not Signed; Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives. 'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday The Origin of Life is a four-billion-year detective story that uses the latest sci. book. Codice libro della libreria ria9780241954690_rkm

Maggiori informazioni su questa libreria | Fare una domanda alla libreria

Compra nuovo
EUR 9,27
Convertire valuta

Aggiungere al carrello

Spese di spedizione: EUR 3,86
Da: Regno Unito a: U.S.A.
Destinazione, tempi e costi

8.

Rutherford, Adam
Editore: Penguin Books Ltd
ISBN 10: 024195469X ISBN 13: 9780241954690
Nuovi Brossura Quantità: 16
Da
Kennys Bookstore
(Olney, MD, U.S.A.)
Valutazione libreria
[?]

Descrizione libro Penguin Books Ltd. Condizione libro: New. Tells a story that uses science to explain what life is and where it first came from, offering answers to the very grandest of questions before arriving at a fresh solution. Num Pages: 272 pages. BIC Classification: PDZ; PSAJ. Category: (G) General (US: Trade). Dimension: 197 x 129 x 20. Weight in Grams: 258. . 2014. Paperback. . . . . Books ship from the US and Ireland. Codice libro della libreria V9780241954690

Maggiori informazioni su questa libreria | Fare una domanda alla libreria

Compra nuovo
EUR 13,38
Convertire valuta

Aggiungere al carrello

Spese di spedizione: GRATIS
In U.S.A.
Destinazione, tempi e costi

9.

Adam Rutherford
Editore: Penguin Books Ltd 2014-02-06, London (2014)
ISBN 10: 024195469X ISBN 13: 9780241954690
Nuovi paperback Quantità: 5
Da
Blackwell's
(Oxford, OX, Regno Unito)
Valutazione libreria
[?]

Descrizione libro Penguin Books Ltd 2014-02-06, London, 2014. paperback. Condizione libro: New. Codice libro della libreria 9780241954690

Maggiori informazioni su questa libreria | Fare una domanda alla libreria

Compra nuovo
EUR 9,10
Convertire valuta

Aggiungere al carrello

Spese di spedizione: EUR 5,20
Da: Regno Unito a: U.S.A.
Destinazione, tempi e costi

10.

Adam Rutherford
ISBN 10: 024195469X ISBN 13: 9780241954690
Nuovi Quantità: 1
Da
Grand Eagle Retail
(Wilmington, DE, U.S.A.)
Valutazione libreria
[?]

Descrizione libro 2014. Condizione libro: New. 129mm x 198mm x 22mm. Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives. Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller. .Shipping may be from multiple locations in the US or from the UK, depending on stock availability. 272 pages. 0.303. Codice libro della libreria 9780241954690

Maggiori informazioni su questa libreria | Fare una domanda alla libreria

Compra nuovo
EUR 14,36
Convertire valuta

Aggiungere al carrello

Spese di spedizione: GRATIS
In U.S.A.
Destinazione, tempi e costi

Vedi altre copie di questo libro

Vedi tutti i risultati per questo libro