Articoli correlati a Creation: The Origin of Life / The Future of Life

Creation: The Origin of Life / The Future of Life - Brossura

 
9780241954690: Creation: The Origin of Life / The Future of Life
Vedi tutte le copie di questo ISBN:
 
 

Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives.

'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday

The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, offering answers to the very grandest of questions before arriving at a thrilling solution.

'A superbly written explanation' Brian Cox

This same science has led to a technological revolution: the ability to create entirely new life forms within the lab, known as synthetic biology. The Future of Life introduces these remarkable innovations, explains how they work, and presents a powerful argument for their benefit to humankind.

'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating.' Sunday Telegraph

'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer

'The perfect primer on the past and future of DNA' Guardian

'Susenseful, erudite and thrilling' Prospect

'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain

'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili

'A fascinating glimpse into our past and future. Rutherford argues persuasively against those who seek to hold back scientific progress. His illuminating book is full of optimism about what we might be able to achieve' Sunday Times

'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk

'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts

'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome

'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times

Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book.

TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG

Le informazioni nella sezione "Riassunto" possono far riferimento a edizioni diverse di questo titolo.

Recensione:
Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller (Mail on Sunday)

One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet (Observer)

Fascinating. The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny (Sunday Telegraph)

The perfect primer on the past and future of DNA (Guardian)
L'autore:
Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book.

Le informazioni nella sezione "Su questo libro" possono far riferimento a edizioni diverse di questo titolo.

  • EditorePenguin
  • Data di pubblicazione2014
  • ISBN 10 024195469X
  • ISBN 13 9780241954690
  • RilegaturaCopertina flessibile
  • Numero di pagine272
  • Valutazione libreria

Altre edizioni note dello stesso titolo

9781617230110: Creation: How Science Is Reinventing Life Itself

Edizione in evidenza

ISBN 10:  1617230111 ISBN 13:  9781617230110
Casa editrice: Current, 2014
Brossura

  • 9781617230059: Creation: How Science Is Reinventing Life Itself

    Current, 2013
    Rilegato

  • 9780670920440: Creation: The Origin of Life / The Future of Life

    Viking, 2013
    Rilegato

  • 9780670920464: Creation: The Origin of Life / The Future of Life

    Viking, 2013
    Brossura

I migliori risultati di ricerca su AbeBooks

Immagini fornite dal venditore

Adam Rutherford
ISBN 10: 024195469X ISBN 13: 9780241954690
Nuovo Paperback Quantità: 1
Da:
Grand Eagle Retail
(Wilmington, DE, U.S.A.)
Valutazione libreria

Descrizione libro Paperback. Condizione: new. Paperback. Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives.Creation- The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, offering answers to the very grandest of questions before arriving at a thrilling solution.This same science has led to a technological revolution- the ability to create entirely new life forms within the lab, known as synthetic biology. The Future of Life introduces these remarkable innovations, explains how they work, and presents a powerful argument for their benefit to humankind. Tells a story that uses science to explain what life is and where it first came from, offering answers to the very grandest of questions before arriving at a fresh solution. Shipping may be from multiple locations in the US or from the UK, depending on stock availability. Codice articolo 9780241954690

Informazioni sul venditore | Contatta il venditore

Compra nuovo
EUR 16,30
Convertire valuta

Aggiungere al carrello

Spese di spedizione: GRATIS
In U.S.A.
Destinazione, tempi e costi
Foto dell'editore

Adam Rutherford, Adam Rutherford
ISBN 10: 024195469X ISBN 13: 9780241954690
Nuovo paperback Quantità: 10
Da:
Blackwell's
(London, Regno Unito)
Valutazione libreria

Descrizione libro paperback. Condizione: New. Language: ENG. Codice articolo 9780241954690

Informazioni sul venditore | Contatta il venditore

Compra nuovo
EUR 12,30
Convertire valuta

Aggiungere al carrello

Spese di spedizione: EUR 5,25
Da: Regno Unito a: U.S.A.
Destinazione, tempi e costi
Foto dell'editore

Rutherford Adam
Editore: Penguin Books (2014)
ISBN 10: 024195469X ISBN 13: 9780241954690
Nuovo Brossura Quantità: 1
Da:
Majestic Books
(Hounslow, Regno Unito)
Valutazione libreria

Descrizione libro Condizione: New. pp. 272. Codice articolo 95961182

Informazioni sul venditore | Contatta il venditore

Compra nuovo
EUR 11,12
Convertire valuta

Aggiungere al carrello

Spese di spedizione: EUR 7,59
Da: Regno Unito a: U.S.A.
Destinazione, tempi e costi
Foto dell'editore

Adam Rutherford
Editore: Penguin (2014)
ISBN 10: 024195469X ISBN 13: 9780241954690
Nuovo Brossura Quantità: 1
Da:
Books Unplugged
(Amherst, NY, U.S.A.)
Valutazione libreria

Descrizione libro Condizione: New. Buy with confidence! Book is in new, never-used condition. Codice articolo bk024195469Xxvz189zvxnew

Informazioni sul venditore | Contatta il venditore

Compra nuovo
EUR 21,62
Convertire valuta

Aggiungere al carrello

Spese di spedizione: GRATIS
In U.S.A.
Destinazione, tempi e costi
Foto dell'editore

Adam Rutherford
Editore: Penguin (2014)
ISBN 10: 024195469X ISBN 13: 9780241954690
Nuovo Brossura Quantità: 1
Da:
Book Deals
(Tucson, AZ, U.S.A.)
Valutazione libreria

Descrizione libro Condizione: New. New! This book is in the same immaculate condition as when it was published. Codice articolo 353-024195469X-new

Informazioni sul venditore | Contatta il venditore

Compra nuovo
EUR 21,62
Convertire valuta

Aggiungere al carrello

Spese di spedizione: GRATIS
In U.S.A.
Destinazione, tempi e costi
Foto dell'editore

Adam Rutherford
Editore: Penguin (2014)
ISBN 10: 024195469X ISBN 13: 9780241954690
Nuovo Paperback Quantità: 1
Da:
Ergodebooks
(Houston, TX, U.S.A.)
Valutazione libreria

Descrizione libro Paperback. Condizione: New. Codice articolo DADAX024195469X

Informazioni sul venditore | Contatta il venditore

Compra nuovo
EUR 21,65
Convertire valuta

Aggiungere al carrello

Spese di spedizione: GRATIS
In U.S.A.
Destinazione, tempi e costi
Foto dell'editore

Adam Rutherford
Editore: Penguin (2014)
ISBN 10: 024195469X ISBN 13: 9780241954690
Nuovo Paperback Quantità: 2
Da:
Monster Bookshop
(Fleckney, Regno Unito)
Valutazione libreria

Descrizione libro Paperback. Condizione: New. BRAND NEW ** SUPER FAST SHIPPING FROM UK WAREHOUSE ** 30 DAY MONEY BACK GUARANTEE. Codice articolo 9780241954690-GDR

Informazioni sul venditore | Contatta il venditore

Compra nuovo
EUR 11,64
Convertire valuta

Aggiungere al carrello

Spese di spedizione: EUR 10,50
Da: Regno Unito a: U.S.A.
Destinazione, tempi e costi
Foto dell'editore

Adam Rutherford
Editore: Penguin (2014)
ISBN 10: 024195469X ISBN 13: 9780241954690
Nuovo Brossura Quantità: 2
Valutazione libreria

Descrizione libro Condizione: New. Tells a story that uses science to explain what life is and where it first came from, offering answers to the very grandest of questions before arriving at a fresh solution. Num Pages: 272 pages. BIC Classification: PDZ; PSAJ. Category: (G) General (US: Trade). Dimension: 197 x 129 x 20. Weight in Grams: 258. 2014. Paperback. . . . . Codice articolo 9780241954690

Informazioni sul venditore | Contatta il venditore

Compra nuovo
EUR 12,30
Convertire valuta

Aggiungere al carrello

Spese di spedizione: EUR 10,50
Da: Irlanda a: U.S.A.
Destinazione, tempi e costi
Foto dell'editore

Adam Rutherford
Editore: Penguin (2014)
ISBN 10: 024195469X ISBN 13: 9780241954690
Nuovo Brossura Quantità: 2
Da:
Kennys Bookstore
(Olney, MD, U.S.A.)
Valutazione libreria

Descrizione libro Condizione: New. Tells a story that uses science to explain what life is and where it first came from, offering answers to the very grandest of questions before arriving at a fresh solution. Num Pages: 272 pages. BIC Classification: PDZ; PSAJ. Category: (G) General (US: Trade). Dimension: 197 x 129 x 20. Weight in Grams: 258. 2014. Paperback. . . . . Books ship from the US and Ireland. Codice articolo 9780241954690

Informazioni sul venditore | Contatta il venditore

Compra nuovo
EUR 13,45
Convertire valuta

Aggiungere al carrello

Spese di spedizione: EUR 9,81
In U.S.A.
Destinazione, tempi e costi
Foto dell'editore

Adam Rutherford
Editore: Penguin (2014)
ISBN 10: 024195469X ISBN 13: 9780241954690
Nuovo Brossura Quantità: > 20
Da:
Ria Christie Collections
(Uxbridge, Regno Unito)
Valutazione libreria

Descrizione libro Condizione: New. In. Codice articolo ria9780241954690_new

Informazioni sul venditore | Contatta il venditore

Compra nuovo
EUR 12,17
Convertire valuta

Aggiungere al carrello

Spese di spedizione: EUR 11,65
Da: Regno Unito a: U.S.A.
Destinazione, tempi e costi

Vedi altre copie di questo libro

Vedi tutti i risultati per questo libro