Rudolf dernick (15 risultati)
Lingua: Inglese
Editore: Springer-Verlag Berlin and Heidelberg GmbH & Co. K, 1989
- Rilegato
Da: Ammareal, Morangis, FranciaAmmareal
Contatta il venditoreVenditore con 5 stelleCondizione: Usato - Ottimo
EUR 5,01
EUR 16,50 spedizioneSpedito da Francia a U.S.A.Quantità: 1 disponibili
Hardcover. Condizione: Très bon. Ancien livre de bibliothèque. Edition 1989. Ammareal reverse jusqu'à 15% du prix net de cet article à des organisations caritatives. ENGLISH DESCRIPTION Book Condition: Used, Very good. Former library book. Edition 1989. Ammareal gives back up to 15% of this item's net price to charity organizati…ons.
Vectors As Tools for the Study of Normal and Abnormal Growth and Differentiation
Lother, Heinz (EDT); Dernick, Rudolf (EDT); Ostertag, Wolfram (EDT)
- Brossura
Da: GreatBookPrices, Columbia, MD, U.S.A.GreatBookPrices
Contatta il venditoreVenditore con 5 stelleCondizione: Usato - Come nuovo
EUR 124,55
EUR 2,31 spedizioneSpedito in U.S.A.Quantità: 15 disponibili
Condizione: As New. Unread book in perfect condition.
- Brossura
Da: Ria Christie Collections, Uxbridge, Regno UnitoRia Christie Collections
Contatta il venditoreVenditore con 5 stelleCondizione: Nuovo
EUR 116,48
EUR 13,98 spedizioneSpedito da Regno Unito a U.S.A.Quantità: Più di 20 disponibili
Condizione: New. In.
Vectors As Tools for the Study of Normal and Abnormal Growth and Differentiation
NATO Advanced Research Workshop On "Vectors For Transfer And Expression Of Genes" (1988 : Wilsede, Germany); Dernick, Rudolf; Lother, Heinz; Heinrich-Pette-Institut Fur Experimentelle Virologie Und Immunologie; North Atlantic Treaty Organization. Scientific Affairs Division
- Brossura
Da: Romtrade Corp., STERLING HEIGHTS, MI, U.S.A.Romtrade Corp.
Contatta il venditoreVenditore con 5 stelleCondizione: Nuovo
EUR 133,66
Spedizione gratuitaSpedito in U.S.A.Quantità: 1 disponibili
Condizione: New. This is a Brand-new US Edition. This Item may be shipped from US or any other country as we have multiple locations worldwide.
Vectors As Tools for the Study of Normal and Abnormal Growth and Differentiation
Lother, Heinz (EDT); Dernick, Rudolf (EDT); Ostertag, Wolfram (EDT)
- Brossura
Da: GreatBookPrices, Columbia, MD, U.S.A.GreatBookPrices
Contatta il venditoreVenditore con 5 stelleCondizione: Nuovo
EUR 131,99
EUR 2,31 spedizioneSpedito in U.S.A.Quantità: 15 disponibili
Condizione: New.
Lingua: Inglese
Editore: Berlin ; Heidelberg ; New York ; London ; Paris ; Tokyo : Springer,, 1989
- Rilegato
Da: Die Wortfreunde - Antiquariat Wirthwein Matthias Wirthwein, Mannheim, GermaniaDie Wortfreunde - Antiquariat Wirthwein Matthias Wirthwein
Contatta il venditoreVenditore con 5 stelleCondizione: Usato
EUR 99,00
EUR 39,00 spedizioneSpedito da Germania a U.S.A.Quantità: 2 disponibili
gr.-8°,OPp, gebundene Ausgabe. VIII, 475 S : graph. Darst. ; 25 cm Fast neuwertiges, ungelesenes Exemplar. Sprache: Englisch Gewicht in Gramm: 1200.
- Brossura
Da: Books Puddle, New York, NY, U.S.A.Books Puddle
Contatta il venditoreVenditore con 4 stelleCondizione: Usato
EUR 145,87
EUR 3,49 spedizioneSpedito in U.S.A.Quantità: 1 disponibili
Condizione: Used. pp. 475 1st Edition.
- Brossura
Da: Books Puddle, New York, NY, U.S.A.Books Puddle
Contatta il venditoreVenditore con 4 stelleCondizione: Nuovo
EUR 151,76
EUR 3,49 spedizioneSpedito in U.S.A.Quantità: 4 disponibili
Condizione: New. pp. viii + 477.
- Brossura
Da: Majestic Books, Hounslow, Regno UnitoMajestic Books
Contatta il venditoreVenditore con 4 stelleCondizione: Usato
EUR 152,39
EUR 7,59 spedizioneSpedito da Regno Unito a U.S.A.Quantità: 1 disponibili
Condizione: Used. pp. 475.
- Brossura
Da: Biblios, frankfurt am main, HESSE, GermaniaBiblios
Contatta il venditoreVenditore con 4 stelleCondizione: Usato
EUR 152,76
EUR 9,95 spedizioneSpedito da Germania a U.S.A.Quantità: 1 disponibili
Condizione: Used. pp. 475.
- Brossura
Da: moluna, Greven, Germaniamoluna
Contatta il venditoreVenditore con 5 stelleCondizione: Nuovo
EUR 118,64
EUR 48,99 spedizioneSpedito da Germania a U.S.A.Quantità: Più di 20 disponibili
Condizione: New. Proceedings of the NATO Advanced Research Workshop on Vectors for Transfer and Expression of Genes held in Wilsede, FRG, October 21-24, 1988 on the Occasion of the 40th Anniversary of the Heinrich-Pette-Institut fuerExperimentelle Virologie u. Immunologie an.
- Brossura
Da: Revaluation Books, Exeter, Regno UnitoRevaluation Books
Contatta il venditoreVenditore con 5 stelleCondizione: Nuovo
EUR 159,12
EUR 14,59 spedizioneSpedito da Regno Unito a U.S.A.Quantità: 2 disponibili
Paperback. Condizione: Brand New. reprint edition. 485 pages. 9.53x1.11x6.69 inches. In Stock.
Lingua: Inglese
Editore: Springer, Berlin, Springer Berlin Heidelberg, Springer, 2011
- Brossura
Da: AHA-BUCH GmbH, Einbeck, GermaniaAHA-BUCH GmbH
Contatta il venditoreVenditore con 5 stelleCondizione: Nuovo
EUR 146,51
EUR 64,17 spedizioneSpedito da Germania a U.S.A.Quantità: 2 disponibili
Taschenbuch. Condizione: Neu. Neuware - Helper T cells activate a set of lymphokine genes upon recognition of antigens presented in the context of the major histocompatibility complex on antigen presenting cells (Arai et al. , 1986; Miyajima et al. , 1988). Activation of T cells proceeds in two distinct stages. The flrst step is… triggered by binding of an antigen to the T cell antigen receptor/CD3 complex that leads to the activation of protein kinase C (PKC) and an increase in intracellular Ca2+. This step, which is substituted by phorbol ester and calcium ionophore (Weiss et al. , 1984), possibly proceeds through GTP binding protein and phospholipase C. The second step is the downstream events of PKC activation for transmission of the intracellular signals to the nucleus and is likely to involve protein phosphorylation. In this review, we focus on the downwstream events of PKC activa tion for activation of lymphokine genes. To characterize a series of biochemical reactions, we toke several approaches to (1) deflne the regulatory region of the GM-CSF and other lymphokine genes that mediates the response to T cell activation signals or viral transactivators, (2) develop a faithful in vitro transcription system of lymphokine genes which is dependent on regulatory sequence and activation signals, (3) characterize proteins that interact with the regulatory regions, and (4) search for critical target(s) for PKC activation. CLEl CLE2 GC box GGCCAGGAGATTCCACAACTCAGGTAGTTCCCCCGCCCCCCTGGAGTTCTGTGG -72 -60 -113 -96 -84 GGAGATTCCCC IL-2R (p55) . . .
- Brossura
- Print on Demand
Da: Majestic Books, Hounslow, Regno UnitoMajestic Books
Contatta il venditoreVenditore con 4 stelleCondizione: Nuovo
EUR 157,61
EUR 7,59 spedizioneSpedito da Regno Unito a U.S.A.Quantità: 4 disponibili
Condizione: New. Print on Demand pp. viii + 477 100 Figures.
- Brossura
- Print on Demand
Da: Biblios, frankfurt am main, HESSE, GermaniaBiblios
Contatta il venditoreVenditore con 4 stelleCondizione: Nuovo
EUR 156,48
EUR 9,95 spedizioneSpedito da Germania a U.S.A.Quantità: 4 disponibili
Condizione: New. PRINT ON DEMAND pp. viii + 477.
