Importo totale (1 articolo articoli):
Destinazione ordine:
vectors tools study normal (14 risultati)
Vai alla pagina principale dei risultati di ricerca
Filtri di ricerca
Tipo di articolo
- Tutti i tipi di prodotto
- Libri (14)
- Riviste e Giornali (Nessun altro risultato corrispondente a questo perfezionamento)
- Fumetti (Nessun altro risultato corrispondente a questo perfezionamento)
- Spartiti (Nessun altro risultato corrispondente a questo perfezionamento)
- Arte, Stampe e Poster (Nessun altro risultato corrispondente a questo perfezionamento)
- Fotografie (Nessun altro risultato corrispondente a questo perfezionamento)
- Mappe (Nessun altro risultato corrispondente a questo perfezionamento)
- Manoscritti e Collezionismo cartaceo (Nessun altro risultato corrispondente a questo perfezionamento)
Condizioni Maggiori informazioni
- Nuovo (9)
- Come nuovo, Ottimo o Quasi ottimo (1)
- Molto buono o Buono (Nessun altro risultato corrispondente a questo perfezionamento)
- Discreto o Mediocre (Nessun altro risultato corrispondente a questo perfezionamento)
- Come descritto (4)
Legatura
Ulteriori caratteristiche
- Prima ed. (Nessun altro risultato corrispondente a questo perfezionamento)
- Copia autograf. (Nessun altro risultato corrispondente a questo perfezionamento)
- Sovracoperta (Nessun altro risultato corrispondente a questo perfezionamento)
- Con foto (3)
- Non Print on Demand (12)
Lingua (1)
Spedizione gratuita
Paese del venditore
Valutazione venditore
-
Vectors as Tools for the Study of Normal and Abnormal Growth and Differentiation
Lingua: Inglese
Editore: Springer-Verlag Berlin and Heidelberg GmbH & Co. K, 1989
ISBN 10: 3540504192 ISBN 13: 9783540504191
AffareEUR 5,01
Spedizione EUR 16,50
Spedito da Francia a U.S.A.Quantità: 1 disponibili
Aggiungi al carrelloHardcover. Condizione: Très bon. Ancien livre de bibliothèque. Edition 1989. Ammareal reverse jusqu'à 15% du prix net de cet article à des organisations caritatives. ENGLISH DESCRIPTION Book Condition: Used, Very good. Former library book. Edition 1989. Ammareal gives back up to 15% of this item's net price to charity organizations.
-
Vectors as Tools for the Study of Normal and Abnormal Growth and Differentiation (Nato ASI Subseries H:, 34)
Da: Ria Christie Collections, Uxbridge, Regno Unito
Valutazione del venditore 5 su 5 stelle
EUR 113,55
Spedizione EUR 13,74
Spedito da Regno Unito a U.S.A.Quantità: Più di 20 disponibili
Aggiungi al carrelloCondizione: New. In.
-
Vectors As Tools for the Study of Normal and Abnormal Growth and Differentiation
Da: Basi6 International, Irving, TX, U.S.A.
Valutazione del venditore 5 su 5 stelle
Condizione: Brand New. New. US edition. Expediting shipping for all USA and Europe orders excluding PO Box. Excellent Customer Service.
-
Vectors As Tools for the Study of Normal and Abnormal Growth and Differentiation
Da: Romtrade Corp., STERLING HEIGHTS, MI, U.S.A.
Valutazione del venditore 5 su 5 stelle
Condizione: New. This is a Brand-new US Edition. This Item may be shipped from US or any other country as we have multiple locations worldwide.
-
![Immagine del venditore per Vectors as tools for the study of normal and abnormal growth and differentiation : [proceedings of the NATO Advanced Research Workshop on Vectors for Transfer and Expression of Genes held in Wilsede, FRG, October 21 - 24, 1988 on the occasion of the 40th anniversary of the Heinrich-Pette-Institut für Experimentelle Virologie und Immunologie an der Universität Hamburg (HPI)]. ed. by H. Lother . Publ. in coop. with NATO Scientif. Affairs Div. / NATO: NATO ASI series / Series H, Cell biology ; Vol. 34 venduto da Die Wortfreunde - Antiquariat Wirthwein Matthias Wirthwein](https://pictures.abebooks.com/inventory/md/md30732786818.jpg)
Vectors as tools for the study of normal and abnormal growth and differentiation : [proceedings of the NATO Advanced Research Workshop on Vectors for Transfer and Expression of Genes held in Wilsede, FRG, October 21 - 24, 1988 on the occasion of the 40th anniversary of the Heinrich-Pette-Institut für Experimentelle Virologie und Immunologie an der Universität Hamburg (HPI)]. ed. by H. Lother . Publ. in coop. with NATO Scientif. Affairs Div. / NATO: NATO ASI series / Series H, Cell biology ; Vol. 34
Lingua: Inglese
Editore: Berlin ; Heidelberg ; New York ; London ; Paris ; Tokyo : Springer,, 1989
ISBN 10: 3540504192 ISBN 13: 9783540504191
Da: Die Wortfreunde - Antiquariat Wirthwein Matthias Wirthwein, Mannheim, Germania
Valutazione del venditore 5 su 5 stelle
EUR 99,00
Spedizione EUR 39,00
Spedito da Germania a U.S.A.Quantità: 2 disponibili
Aggiungi al carrellogr.-8°,OPp, gebundene Ausgabe. VIII, 475 S : graph. Darst. ; 25 cm Fast neuwertiges, ungelesenes Exemplar. Sprache: Englisch Gewicht in Gramm: 1200.
-
Vectors as Tools for the Study of Normal and Abnormal Growth and Differentiation
Da: Books Puddle, New York, NY, U.S.A.
Valutazione del venditore 4 su 5 stelle
Condizione: New. pp. viii + 477.
-
Vectors As Tools for the Study of Normal and Abnormal Growth and Differentiation
Da: Books Puddle, New York, NY, U.S.A.
Valutazione del venditore 4 su 5 stelle
Condizione: Used. pp. 475 1st Edition.
-
Vectors As Tools for the Study of Normal and Abnormal Growth and Differentiation (Nato Asi Series (Closed) / Nato Asi Subseries H: (Closed))
Da: Revaluation Books, Exeter, Regno Unito
Valutazione del venditore 5 su 5 stelle
EUR 155,05
Spedizione EUR 14,33
Spedito da Regno Unito a U.S.A.Quantità: 2 disponibili
Aggiungi al carrelloPaperback. Condizione: Brand New. reprint edition. 485 pages. 9.53x1.11x6.69 inches. In Stock.
-
Vectors as Tools for the Study of Normal and Abnormal Growth and Differentiation
Lingua: Inglese
Editore: Springer Berlin Heidelberg, 2011
ISBN 10: 3642741991 ISBN 13: 9783642741999
EUR 118,64
Spedizione EUR 48,99
Spedito da Germania a U.S.A.Quantità: Più di 20 disponibili
Aggiungi al carrelloCondizione: New. Proceedings of the NATO Advanced Research Workshop on Vectors for Transfer and Expression of Genes held in Wilsede, FRG, October 21-24, 1988 on the Occasion of the 40th Anniversary of the Heinrich-Pette-Institut fuerExperimentelle Virologie u. Immunologie an.
-
Vectors As Tools for the Study of Normal and Abnormal Growth and Differentiation
Da: Biblios, Frankfurt am main, HESSE, Germania
Valutazione del venditore 4 su 5 stelle
EUR 162,61
Spedizione EUR 9,95
Spedito da Germania a U.S.A.Quantità: 1 disponibili
Aggiungi al carrelloCondizione: Used. pp. 475.
-
Vectors As Tools for the Study of Normal and Abnormal Growth and Differentiation
Da: Majestic Books, Hounslow, Regno Unito
Valutazione del venditore 4 su 5 stelle
EUR 176,47
Spedizione EUR 7,45
Spedito da Regno Unito a U.S.A.Quantità: 1 disponibili
Aggiungi al carrelloCondizione: Used. pp. 475.
-
Vectors as Tools for the Study of Normal and Abnormal Growth and Differentiation
Lingua: Inglese
Editore: Springer, Berlin, Springer Berlin Heidelberg, Springer, 2011
ISBN 10: 3642741991 ISBN 13: 9783642741999
EUR 146,51
Spedizione EUR 64,17
Spedito da Germania a U.S.A.Quantità: 2 disponibili
Aggiungi al carrelloTaschenbuch. Condizione: Neu. Neuware - Helper T cells activate a set of lymphokine genes upon recognition of antigens presented in the context of the major histocompatibility complex on antigen presenting cells (Arai et al. , 1986; Miyajima et al. , 1988). Activation of T cells proceeds in two distinct stages. The flrst step is triggered by binding of an antigen to the T cell antigen receptor/CD3 complex that leads to the activation of protein kinase C (PKC) and an increase in intracellular Ca2+. This step, which is substituted by phorbol ester and calcium ionophore (Weiss et al. , 1984), possibly proceeds through GTP binding protein and phospholipase C. The second step is the downstream events of PKC activation for transmission of the intracellular signals to the nucleus and is likely to involve protein phosphorylation. In this review, we focus on the downwstream events of PKC activa tion for activation of lymphokine genes. To characterize a series of biochemical reactions, we toke several approaches to (1) deflne the regulatory region of the GM-CSF and other lymphokine genes that mediates the response to T cell activation signals or viral transactivators, (2) develop a faithful in vitro transcription system of lymphokine genes which is dependent on regulatory sequence and activation signals, (3) characterize proteins that interact with the regulatory regions, and (4) search for critical target(s) for PKC activation. CLEl CLE2 GC box GGCCAGGAGATTCCACAACTCAGGTAGTTCCCCCGCCCCCCTGGAGTTCTGTGG -72 -60 -113 -96 -84 GGAGATTCCCC IL-2R (p55) . . .
-
Vectors as Tools for the Study of Normal and Abnormal Growth and Differentiation
Da: Majestic Books, Hounslow, Regno Unito
Valutazione del venditore 4 su 5 stelle
EUR 151,88
Spedizione EUR 7,45
Spedito da Regno Unito a U.S.A.Quantità: 4 disponibili
Aggiungi al carrelloCondizione: New. Print on Demand pp. viii + 477 100 Figures.
-
Vectors as Tools for the Study of Normal and Abnormal Growth and Differentiation
Da: Biblios, Frankfurt am main, HESSE, Germania
Valutazione del venditore 4 su 5 stelle
EUR 152,32
Spedizione EUR 9,95
Spedito da Germania a U.S.A.Quantità: 4 disponibili
Aggiungi al carrelloCondizione: New. PRINT ON DEMAND pp. viii + 477.
